Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGCTAAATTCCAGACAGAGAAACC[A/G]TCCTCCTGGTTTCAGCACCCGATGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616359 MIM: 601562 MIM: 616207 | ||||||||||||||||||||
Literature Links: |
COQ5 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
COQ5 - coenzyme Q5, methyltransferase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032314.3 | 741 | Silent Mutation | NP_115690.3 | |||
XM_006719639.2 | 741 | Missense Mutation | XP_006719702.1 |
DYNLL1 - dynein light chain LC8-type 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NRAV - negative regulator of antiviral response (non-protein coding) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |