Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAAAGACCCCTCACGATGAATGCTC[A/T]TCAGCCAGCTTATCAGCTTTTGCCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 102910 MIM: 605682 | ||||||||||||||||||||
Literature Links: |
ATP5B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATP5B - ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001686.3 | 1680 | Missense Mutation | GAA,GAT | E,D 525 | NP_001677.2 |
BAZ2A - bromodomain adjacent to zinc finger domain 2A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD59A - small nucleolar RNA, C/D box 59A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD59B - small nucleolar RNA, C/D box 59B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |