Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGAGGGCAAGCAGCTCAGCCTGCA[C/T]GAGGTGAGAACCCCCAGGCCTCCTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602381 MIM: 616496 MIM: 601512 | ||||||||||||||||||||
Literature Links: |
NAB2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
NAB2 - NGFI-A binding protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005967.3 | 1332 | Silent Mutation | CAC,CAT | H,H 318 | NP_005958.1 | |
XM_005268894.2 | 1332 | Silent Mutation | CAC,CAT | H,H 318 | XP_005268951.1 |
NEMP1 - nuclear envelope integral membrane protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STAT6 - signal transducer and activator of transcription 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |