Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAACACAGTGACCAACTTGTTAATT[A/T]TGCCAGTTGTGACATTTGAGCCCAC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||||||||||||||||||||
Literature Links: |
C12orf60 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C12orf60 - chromosome 12 open reading frame 60 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_175874.3 | 3169 | Intron | NP_787070.2 | |||
XM_005253322.4 | 3169 | Intron | XP_005253379.1 | |||
XM_011520568.2 | 3169 | Intron | XP_011518870.1 | |||
XM_011520569.2 | 3169 | Intron | XP_011518871.1 | |||
XM_017018871.1 | 3169 | Intron | XP_016874360.1 | |||
XM_017018872.1 | 3169 | Intron | XP_016874361.1 | |||
XM_017018873.1 | 3169 | Intron | XP_016874362.1 | |||
XM_017018874.1 | 3169 | Intron | XP_016874363.1 |
SMCO3 - single-pass membrane protein with coiled-coil domains 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001013698.2 | 3169 | Missense Mutation | AAA,ATA | K,I 144 | NP_001013720.2 | |
XM_017019312.1 | 3169 | Missense Mutation | AAA,ATA | K,I 144 | XP_016874801.1 |
WBP11 - WW domain binding protein 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |