Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTAGCGCAATAACTGGTATGGGTCT[A/G]TGTTTCCGCTGTCTTCTTTTTTCTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612800 MIM: 601566 | ||||||||||||||||||||
Literature Links: |
CARS2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CARS2 - cysteinyl-tRNA synthetase 2, mitochondrial (putative) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ING1 - inhibitor of growth family member 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001267728.1 | 528 | Intron | NP_001254657.1 | |||
NM_005537.5 | 528 | Silent Mutation | CTA,CTG | L,L 32 | NP_005528.4 | |
NM_198217.2 | 528 | Intron | NP_937860.1 | |||
NM_198218.2 | 528 | Intron | NP_937861.1 | |||
NM_198219.2 | 528 | Intron | NP_937862.1 |
LOC105376684 - translation initiation factor IF-2-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |