Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCGGCCCTGCCTGAAGTGCGAGAAA[C/T]GTGGGAAGACGCTGACCTCTGGGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 123875 MIM: 601183 | ||||||||||||||||||||
Literature Links: |
C14orf80 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C14orf80 - chromosome 14 open reading frame 80 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CRIP1 - cysteine rich protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001311.4 | 214 | Missense Mutation | CGT,TGT | R,C 34 | NP_001302.1 |
CRIP2 - cysteine rich protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |