Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTGGTAGTAGGGGCAGCCGTGTGG[C/T]GGGGAGCCGGCCGGGCCTTCCTGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 613317 MIM: 612028 MIM: 600654 | ||||||||||||||||||||
Literature Links: |
DCAF11 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DCAF11 - DDB1 and CUL4 associated factor 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EMC9 - ER membrane protein complex subunit 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FITM1 - fat storage inducing transmembrane protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_203402.2 | 504 | Missense Mutation | CGG,TGG | R,W 136 | NP_981947.1 |
PSME1 - proteasome activator subunit 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |