Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AATACTTACCATGTAAATGGCCTCA[C/T]TGATGACAATATCCTTGACCTTGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603930 MIM: 600154 | ||||||||||||||||||||
Literature Links: |
GPHN PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PIGH - phosphatidylinositol glycan anchor biosynthesis class H | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004569.3 | 473 | Missense Mutation | AAT,AGT | N,S 125 | NP_004560.1 | |
XM_011536838.2 | 473 | Missense Mutation | AAT,AGT | N,S 125 | XP_011535140.1 | |
XM_017021371.1 | 473 | Missense Mutation | AAT,AGT | N,S 125 | XP_016876860.1 | |
XM_017021372.1 | 473 | Missense Mutation | AAT,AGT | N,S 125 | XP_016876861.1 |
PLEKHH1 - pleckstrin homology, MyTH4 and FERM domain containing H1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |