Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTGTGGCTGCCATGTAGGTGCTGC[C/T]GATGGTCTTGATCTTCTCCACCCCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600292 MIM: 604441 MIM: 601531 MIM: 605773 | ||||||||||||||||||||
Literature Links: |
ADCY4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ADCY4 - adenylate cyclase 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001198568.1 | 2900 | Missense Mutation | AGC,GGC | S,G 928 | NP_001185497.1 | |
NM_001198592.1 | 2900 | Missense Mutation | AGC,GGC | S,G 928 | NP_001185521.1 | |
NM_139247.3 | 2900 | Missense Mutation | AGC,GGC | S,G 928 | NP_640340.2 |
CIDEB - cell death-inducing DFFA-like effector b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LTB4R - leukotriene B4 receptor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LTB4R2 - leukotriene B4 receptor 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |