Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCACAGGGTAGGCTTGGAAGAGGT[C/G]TAGGTTCTCCCAAGTTCCAGAACTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
DNM1P35 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DNM1P35 - dynamin 1 pseudogene 35 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ODF3L1 - outer dense fiber of sperm tails 3 like 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_175881.3 | Intron | NP_787077.1 | ||||
XM_006720414.3 | Intron | XP_006720477.1 |