Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCCTTCTCGAAGCTGCCCTTGTCC[A/G]TCACTGAGTACACAATGACATAGGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603118 MIM: 614778 MIM: 179503 | ||||||||||||||||||||
Literature Links: |
CDH16 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CDH16 - cadherin 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FAM96B - family with sequence similarity 96 member B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RRAD - RRAD, Ras related glycolysis inhibitor and calcium channel regulator | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001128850.1 | 658 | Missense Mutation | ACG,ATG | T,M 172 | NP_001122322.1 | |
NM_004165.2 | 658 | Missense Mutation | ACG,ATG | T,M 172 | NP_004156.1 |