Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGAGAGAGTAGTGACACTCAGGAT[C/G]CAAAAGCTAGCCCTGCCCACCCCAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609899 MIM: 614578 MIM: 602474 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
KREMEN2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
KREMEN2 - kringle containing transmembrane protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PAQR4 - progestin and adipoQ receptor family member 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001284511.1 | 2198 | UTR 3 | NP_001271440.1 | |||
NM_001284512.1 | 2198 | UTR 3 | NP_001271441.1 | |||
NM_001284513.1 | 2198 | UTR 3 | NP_001271442.1 | |||
NM_001324118.1 | 2198 | UTR 3 | NP_001311047.1 | |||
NM_152341.4 | 2198 | UTR 3 | NP_689554.2 |
PKMYT1 - protein kinase, membrane associated tyrosine/threonine 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001258450.1 | 2198 | Intron | NP_001245379.1 | |||
NM_001258451.1 | 2198 | Intron | NP_001245380.1 | |||
NM_004203.4 | 2198 | Intron | NP_004194.3 | |||
NM_182687.2 | 2198 | Intron | NP_872629.1 | |||
XM_011522734.2 | 2198 | Intron | XP_011521036.1 | |||
XM_011522735.2 | 2198 | Intron | XP_011521037.1 | |||
XM_011522736.2 | 2198 | Intron | XP_011521038.1 |