Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCCTTCTGGGGTTTGTAGTTCACG[C/T]ATGGCTGGGACGGGGCGGGCAGGGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 617003 MIM: 615798 MIM: 615799 MIM: 615403 MIM: 605914 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
BICDL2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
BICDL2 - BICD family like cargo adaptor 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CLDN6 - claudin 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CLDN9 - claudin 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HCFC1R1 - host cell factor C1 regulator 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001002017.2 | Intron | NP_001002017.1 | ||||
NM_001002018.2 | Intron | NP_001002018.1 | ||||
NM_001288665.1 | Intron | NP_001275594.1 | ||||
NM_001288666.1 | Intron | NP_001275595.1 | ||||
NM_001288667.1 | Intron | NP_001275596.1 | ||||
NM_001288668.1 | Intron | NP_001275597.1 | ||||
NM_001308070.1 | Intron | NP_001294999.1 | ||||
NM_017885.3 | Intron | NP_060355.1 | ||||
XM_011522559.2 | Intron | XP_011520861.1 | ||||
XM_017023384.1 | Intron | XP_016878873.1 |
LOC100128770 - uncharacterized LOC100128770 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
THOC6 - THO complex 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001142350.1 | Intron | NP_001135822.1 | ||||
NM_024339.3 | Intron | NP_077315.2 |
TNFRSF12A - TNF receptor superfamily member 12A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |