Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTGCATGCCAGGTGCCTGCAGGCC[C/T]TGCAGCGACGCTGAGCTGCTCCTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614666 MIM: 610998 | ||||||||||||||||||||
Literature Links: |
CCDC78 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CCDC78 - coiled-coil domain containing 78 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FAM173A - family with sequence similarity 173 member A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HAGHL - hydroxyacylglutathione hydrolase-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
METRN - meteorin, glial cell differentiation regulator | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024042.3 | 636 | Silent Mutation | CCC,CCT | P,P 173 | NP_076947.1 |