Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGCAGGCACCATAAGGATGAAGTG[G/T]CTGGTGACATATTCGACATGCTGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615407 MIM: 600340 MIM: 616585 | ||||||||||||||||||||
Literature Links: |
ARL2BP PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARL2BP - ADP ribosylation factor like GTPase 2 binding protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_012106.3 | 555 | Missense Mutation | GCT,TCT | A,S 105 | NP_036238.1 | |
XM_011522977.1 | 555 | Intron | XP_011521279.1 |
PLLP - plasmolipin | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RSPRY1 - ring finger and SPRY domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |