Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAGTGGGGAAAGAACATCGTCTGC[G/T]TGGGGAGGAACTACGCGGACCACGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616320 MIM: 138760 | ||||||||||||||||||||
Literature Links: |
FAHD1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAHD1 - fumarylacetoacetate hydrolase domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001018104.2 | 73 | Missense Mutation | GTG,TTG | V,L 23 | NP_001018114.1 | |
NM_001142398.1 | 73 | Missense Mutation | GTG,TTG | V,L 23 | NP_001135870.1 | |
NM_031208.3 | 73 | Intron | NP_112485.1 |
HAGH - hydroxyacylglutathione hydrolase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001040427.1 | 73 | Intron | NP_001035517.1 | |||
NM_001286249.1 | 73 | Intron | NP_001273178.1 | |||
NM_005326.4 | 73 | Intron | NP_005317.2 | |||
XM_011522469.2 | 73 | Intron | XP_011520771.1 | |||
XM_011522470.2 | 73 | Intron | XP_011520772.1 | |||
XM_017023195.1 | 73 | Intron | XP_016878684.1 |
MEIOB - meiosis specific with OB domains | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |