Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTGCCACACGGAAGAAGAATTCTC[A/G]GACATTCTCACCTGACACAGAGAGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610917 MIM: 602326 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
NARR PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
NARR - nine-amino acid residue-repeats | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PROCA1 - protein interacting with cyclin A1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAB34 - RAB34, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001142624.2 | 788 | Nonsense Mutation | CGA,TGA | R,* 255 | NP_001136096.2 | |
NM_001142625.2 | 788 | Intron | NP_001136097.2 | |||
NM_001144942.1 | 788 | Nonsense Mutation | CGA,TGA | R,* 198 | NP_001138414.1 | |
NM_001144943.1 | 788 | Nonsense Mutation | CGA,TGA | R,* 263 | NP_001138415.1 | |
NM_001256276.1 | 788 | Nonsense Mutation | CGA,TGA | R,* 184 | NP_001243205.1 | |
NM_001256277.1 | 788 | Nonsense Mutation | CGA,TGA | R,* 206 | NP_001243206.1 | |
NM_001256278.1 | 788 | Nonsense Mutation | CGA,TGA | R,* 206 | NP_001243207.1 | |
NM_031934.5 | 788 | Nonsense Mutation | CGA,TGA | R,* 206 | NP_114140.4 |
RPL23A - ribosomal protein L23a | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD42A - small nucleolar RNA, C/D box 42A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD42B - small nucleolar RNA, C/D box 42B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD4A - small nucleolar RNA, C/D box 4A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD4B - small nucleolar RNA, C/D box 4B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TLCD1 - TLC domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |