Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGGGGAGTGGGAAGTAAGTGGAGA[C/T]ACGTGCTTTGGCCTGTTGGAGGGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601504 | ||||||||||||||||||||
Literature Links: |
MIR6516 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR6516 - microRNA 6516 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCARNA16 - small Cajal body-specific RNA 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SEC14L1 - SEC14 like lipid binding 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001039573.2 | 52 | Intron | NP_001034662.2 | |||
NM_001143998.1 | 52 | Intron | NP_001137470.1 | |||
NM_001143999.1 | 52 | Intron | NP_001137471.1 | |||
NM_001144001.1 | 52 | Intron | NP_001137473.1 | |||
NM_001204408.1 | 52 | UTR 5 | NP_001191337.1 | |||
NM_001204410.1 | 52 | Intron | NP_001191339.1 | |||
NM_003003.3 | 52 | Intron | NP_002994.3 |
SNHG20 - small nucleolar RNA host gene 20 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |