Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTCTGGCTTCGCGTGGTTTCTCTG[G/T]CAGGGTCTCTGCGTGATTTTCTGGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604656 MIM: 604655 | ||||||||||||||||||||
Literature Links: |
FMNL1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FMNL1 - formin like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAP3K14 - mitogen-activated protein kinase kinase kinase 14 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAP3K14-AS1 - MAP3K14 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPATA32 - spermatogenesis associated 32 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_152343.2 | 985 | Missense Mutation | ACA,CCA | T,P 297 | NP_689556.2 |