Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAGGTTCCTGACTCCCCTCGGCTC[C/T]GTCTTCGCCTTCGCCACTAGGGAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600307 MIM: 604657 | ||||||||||||||||||||
Literature Links: |
GLTPD2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GLTPD2 - glycolipid transfer protein domain containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001014985.2 | 564 | Silent Mutation | TCC,TCT | S,S 120 | NP_001014985.2 | |
XM_005256626.3 | 564 | Silent Mutation | TCC,TCT | S,S 156 | XP_005256683.1 |
PSMB6 - proteasome subunit beta 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TM4SF5 - transmembrane 4 L six family member 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
VMO1 - vitelline membrane outer layer 1 homolog | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |