Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCCATGCTGCGCTCTCTCCGCCTG[C/T]AGCAGGAGTGGCTGGAATGGGAGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615056 | ||||||||||||||||||||
Literature Links: |
ASB16 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ASB16 - ankyrin repeat and SOCS box containing 16 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_080863.4 | 139 | Nonsense Mutation | CAG,TAG | Q,* 19 | NP_543139.4 |
ASB16-AS1 - ASB16 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C17orf53 - chromosome 17 open reading frame 53 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |