Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATCCTCTCCATGTTCTCAGCTATCC[A/G]TTCTCAGCACAGCGGTGTAGACATC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616159 MIM: 612275 | ||||||||||||||||||||
Literature Links: |
DHRS11 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DHRS11 - dehydrogenase/reductase 11 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024308.3 | 468 | Missense Mutation | CAT,CGT | H,R 85 | NP_077284.2 | |
XM_005257658.2 | 468 | Missense Mutation | CAT,CGT | H,R 85 | XP_005257715.1 | |
XM_011525233.2 | 468 | Intron | XP_011523535.1 |
GGNBP2 - gametogenetin binding protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRM1 - mitochondrial rRNA methyltransferase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |