Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAACAGGTGTGGTCTCATGTTCACA[C/T]TCACCACCAACCTGGCCATCTGGAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607827 MIM: 607828 MIM: 607696 | ||||||||||||||||||||
Literature Links: |
OTOP2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
OTOP2 - otopetrin 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_178160.2 | 621 | Missense Mutation | CTC,TTC | L,F 177 | NP_835454.1 | |
XM_011525479.1 | 621 | Missense Mutation | CTC,TTC | L,F 177 | XP_011523781.1 |
OTOP3 - otopetrin 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
USH1G - USH1 protein network component sans | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |