Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTTTCACCTTCTCCCTGGAATTAG[C/T]GAATCAGCTCCCATAGCTGAAATCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 616658 MIM: 605490 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
C19orf70 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
C19orf70 - chromosome 19 open reading frame 70 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HSD11B1L - hydroxysteroid 11-beta dehydrogenase 1 like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001267868.1 | Intron | NP_001254797.1 | ||||
NM_001267869.1 | Intron | NP_001254798.1 | ||||
NM_001267870.1 | Intron | NP_001254799.1 | ||||
NM_001267871.1 | Intron | NP_001254800.1 | ||||
NM_198533.2 | Intron | NP_940935.1 | ||||
NM_198704.2 | Intron | NP_941993.1 | ||||
NM_198705.2 | Intron | NP_941994.1 | ||||
NM_198706.2 | Intron | NP_941995.1 | ||||
NM_198707.2 | Intron | NP_941996.1 | ||||
NM_198708.2 | Intron | NP_941997.1 |
LOC107985320 - uncharacterized LOC107985320 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LONP1 - lon peptidase 1, mitochondrial | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL36 - ribosomal protein L36 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |