Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGCAGCCTTCTCTGCCCCCAGGGT[C/T]CCTGCAGCCCCTCCTCAGCTGCTCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607320 MIM: 609293 | ||||||||||||||||||||
Literature Links: |
FAM98C PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAM98C - family with sequence similarity 98 member C | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_174905.3 | 609 | Missense Mutation | TCC,TTC | S,F 197 | NP_777565.3 | |
XM_017026354.1 | 609 | Missense Mutation | CCC,TCC | P,S 187 | XP_016881843.1 |
RASGRP4 - RAS guanyl releasing protein 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPRED3 - sprouty related EVH1 domain containing 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |