Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGACAAGCGGGCCGTGGCCTGGGGG[G/T]AACAGTGAGGGGAAGCAGGACAGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 130410 MIM: 154045 MIM: 606008 | ||||||||||||||||||||
Literature Links: |
CLDND2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CLDND2 - claudin domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ETFB - electron transfer flavoprotein beta subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LIM2 - lens intrinsic membrane protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NKG7 - natural killer cell granule protein 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005601.3 | 426 | Silent Mutation | NP_005592.1 | |||
XM_005258955.3 | 426 | Intron | XP_005259012.1 | |||
XM_006723228.3 | 426 | Intron | XP_006723291.1 |