Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCTGTTGGGGCTGCGCGTCTGGCT[C/T]GGGCTTGAGTTCGATGACGAGGTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607419 MIM: 613226 | ||||||||||||||||||||
Literature Links: |
CLASRP PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CLASRP - CLK4 associating serine/arginine rich protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GEMIN7 - gem nuclear organelle associated protein 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001007269.1 | Intron | NP_001007270.1 | ||||
NM_001007270.1 | Intron | NP_001007271.1 | ||||
NM_001319054.1 | Intron | NP_001305983.1 | ||||
NM_001319055.1 | Intron | NP_001305984.1 | ||||
NM_024707.2 | Intron | NP_078983.1 | ||||
XM_005259262.3 | Intron | XP_005259319.1 | ||||
XM_005259263.4 | Intron | XP_005259320.1 | ||||
XM_017027312.1 | Intron | XP_016882801.1 |
LOC105372419 - uncharacterized LOC105372419 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF296 - zinc finger protein 296 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |