Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAAGGGGCAGAGCCCACGGACAGGG[A/C]CTTCGTAGAGCACAGTGCAAGGCCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614545 MIM: 615324 | ||||||||||||||||||||
Literature Links: |
ASPDH PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ASPDH - aspartate dehydrogenase domain containing | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001024656.2 | 595 | Missense Mutation | GGC,GTC | G,V 73 | NP_001019827.2 | |
NM_001114598.1 | 595 | Missense Mutation | GGC,GTC | G,V 178 | NP_001108070.1 |
EMC10 - ER membrane protein complex subunit 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
JOSD2 - Josephin domain containing 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LRRC4B - leucine rich repeat containing 4B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |