Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTGGCTCGTGCCGCTCTTCTTCGC[A/G]GCGCTGATGCTGCTGGGCCTGGTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603265 MIM: 604161 | ||||||||||||||||||||
Literature Links: |
ARID3A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARID3A - AT-rich interaction domain 3A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KISS1R - KISS1 receptor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032551.4 | 960 | Silent Mutation | GCA,GCG | A,A 50 | NP_115940.2 | |
XM_017027382.1 | 960 | Silent Mutation | GCA,GCG | A,A 50 | XP_016882871.1 |
R3HDM4 - R3H domain containing 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |