Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCGCCCTGTCGCTGGCCAGCACAGG[A/C]GGCTACACAGACATTGTGGGGCTGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 616601 MIM: 608719 MIM: 603200 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
BORCS8 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
BORCS8 - BLOC-1 related complex subunit 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
BORCS8-MEF2B - BORCS8-MEF2B readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NR2C2AP - nuclear receptor 2C2 associated protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RFXANK - regulatory factor X associated ankyrin containing protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001278727.1 | 836 | Silent Mutation | GGA,GGC | G,G 145 | NP_001265656.1 | |
NM_001278728.1 | 836 | Silent Mutation | GGA,GGC | G,G 144 | NP_001265657.1 | |
NM_003721.3 | 836 | Silent Mutation | GGA,GGC | G,G 167 | NP_003712.1 | |
NM_134440.2 | 836 | Silent Mutation | GGA,GGC | G,G 144 | NP_604389.1 | |
XM_005260134.4 | 836 | Silent Mutation | GGA,GGC | G,G 167 | XP_005260191.1 | |
XM_005260135.3 | 836 | Silent Mutation | GGA,GGC | G,G 167 | XP_005260192.1 | |
XM_005260136.4 | 836 | Silent Mutation | GGA,GGC | G,G 166 | XP_005260193.1 | |
XM_005260137.4 | 836 | Silent Mutation | GGA,GGC | G,G 166 | XP_005260194.1 | |
XM_006722930.3 | 836 | Silent Mutation | GGA,GGC | G,G 166 | XP_006722993.1 | |
XM_017027415.1 | 836 | Silent Mutation | GGA,GGC | G,G 167 | XP_016882904.1 | |
XM_017027416.1 | 836 | Silent Mutation | GGA,GGC | G,G 145 | XP_016882905.1 |