Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGTCACATATGTGGGGACAAAGCA[G/T]CTGAGTCCCACAGAGGTGAGCTTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600798 MIM: 608061 | ||||||||||||||||||||
Literature Links: |
NECTIN2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
NECTIN2 - nectin cell adhesion molecule 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TOMM40 - translocase of outer mitochondrial membrane 40 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001128916.1 | Intron | NP_001122388.1 | ||||
NM_001128917.1 | Intron | NP_001122389.1 | ||||
NM_006114.2 | Intron | NP_006105.1 | ||||
XM_005258411.3 | Intron | XP_005258468.1 |