Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGGCAGTTGGGCAGCTCTACTGGC[C/T]CGAGCAGTGGTAACGGGGCTGCTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 137216 MIM: 609169 MIM: 613585 | ||||||||||||||||||||
Literature Links: |
ATP4A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATP4A - ATPase H+/K+ transporting alpha subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GAPDHS - glyceraldehyde-3-phosphate dehydrogenase, spermatogenic | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM147 - transmembrane protein 147 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001242597.1 | 518 | Silent Mutation | GCC,GCT | A,A 151 | NP_001229526.1 | |
NM_001242598.1 | 518 | Silent Mutation | GCC,GCT | A,A 126 | NP_001229527.1 | |
NM_032635.3 | 518 | Silent Mutation | GCC,GCT | A,A 200 | NP_116024.1 |
TMEM147-AS1 - TMEM147 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |