Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTGCTTACCCTTGTGGAACTGGGG[G/T]CTGTAGTGGATGGAGGGGTCCCTCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603934 | ||||||||||||||||||||
Literature Links: |
C19orf52 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C19orf52 - chromosome 19 open reading frame 52 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CARM1 - coactivator associated arginine methyltransferase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
YIPF2 - Yip1 domain family member 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001321439.1 | 655 | Missense Mutation | AGA,AGC | R,S 156 | NP_001308368.1 | |
NM_001321440.1 | 655 | Intron | NP_001308369.1 | |||
NM_024029.4 | 655 | Missense Mutation | AGA,AGC | R,S 156 | NP_076934.1 | |
XM_011528270.2 | 655 | Missense Mutation | AGA,AGC | R,S 156 | XP_011526572.1 | |
XM_011528271.2 | 655 | Missense Mutation | AGA,AGC | R,S 127 | XP_011526573.1 |