Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACAGCAGCGTTTGTCCTTCCCATCT[C/T]GCAGAAGCTGTCTGAGGATCCCTAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606942 MIM: 604800 | ||||||||||||||||||||
Literature Links: |
COPE PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
COPE - coatomer protein complex subunit epsilon | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DDX49 - DEAD-box helicase 49 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_019070.4 | 249 | Missense Mutation | TCG,TTG | S,L 61 | NP_061943.2 | |
XM_011528083.1 | 249 | UTR 5 | XP_011526385.1 | |||
XM_011528084.2 | 249 | Intron | XP_011526386.1 |
HOMER3 - homer scaffolding protein 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |