Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTCCACACTGAGAATGCGGAACGC[C/T]GGGCTAGTCTCTGATAGTCGCTCCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 151440 MIM: 610672 MIM: 164005 MIM: 611669 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
LYL1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
LYL1 - LYL1, basic helix-loop-helix family member | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NACC1 - nucleus accumbens associated 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NFIX - nuclear factor I X | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRMT1 - tRNA methyltransferase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001136035.2 | 2112 | Silent Mutation | CCA,CCG | P,P 518 | NP_001129507.1 | |
NM_001142554.1 | 2112 | Silent Mutation | CCA,CCG | P,P 489 | NP_001136026.1 | |
NM_017722.3 | 2112 | Silent Mutation | CCA,CCG | P,P 518 | NP_060192.1 | |
XM_006722793.2 | 2112 | Silent Mutation | CCA,CCG | P,P 304 | XP_006722856.1 | |
XM_011528124.1 | 2112 | Silent Mutation | CCA,CCG | P,P 482 | XP_011526426.1 | |
XM_011528125.1 | 2112 | Silent Mutation | CCA,CCG | P,P 304 | XP_011526427.1 | |
XM_017026944.1 | 2112 | Silent Mutation | CCA,CCG | P,P 518 | XP_016882433.1 | |
XM_017026945.1 | 2112 | Silent Mutation | CCA,CCG | P,P 489 | XP_016882434.1 | |
XM_017026946.1 | 2112 | Silent Mutation | CCA,CCG | P,P 275 | XP_016882435.1 | |
XM_017026947.1 | 2112 | Silent Mutation | CCA,CCG | P,P 257 | XP_016882436.1 |