Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCACACCCTGCAGGAGCACCAGAT[A/T]GTCCTTGTGGAGGGCGGCCGCACCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609094 MIM: 603021 MIM: 612804 | ||||||||||||||||||||
Literature Links: |
FBXO17 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FBXO17 - F-box protein 17 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRPS12 - mitochondrial ribosomal protein S12 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_021107.1 | 631 | Silent Mutation | ATA,ATT | I,I 107 | NP_066930.1 | |
NM_033362.3 | 631 | Silent Mutation | ATA,ATT | I,I 107 | NP_203526.1 | |
NM_033363.1 | 631 | Silent Mutation | ATA,ATT | I,I 107 | NP_203527.1 |
SARS2 - seryl-tRNA synthetase 2, mitochondrial | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |