Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCACAGAAGCATTTAAAGGAAGTA[C/T]TGTACTTGATTGTATTAGATTTGAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 608917 | ||||||||||||||||||||
Literature Links: |
ATPAF1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATPAF1 - ATP synthase mitochondrial F1 complex assembly factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
EFCAB14 - EF-hand calcium binding domain 14 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014774.2 | 3735 | UTR 3 | NP_055589.1 |
EFCAB14-AS1 - EFCAB14 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TEX38 - testis expressed 38 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |