Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAAGAGAAGACAAATGTGGACTCTG[C/T]GTTTGTGAACTTCCAGAATGATCGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
9 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 611824 MIM: 605138 MIM: 609501 | ||||||||||||||||||||
Literature Links: |
MRPL9 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MRPL9 - mitochondrial ribosomal protein L9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
OAZ3 - ornithine decarboxylase antizyme 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001134939.1 | 2290 | UTR 3 | NP_001128411.1 | |||
NM_001301371.1 | 2290 | UTR 3 | NP_001288300.1 | |||
NM_016178.2 | 2290 | UTR 3 | NP_057262.2 |
TDRKH - tudor and KH domain containing | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001083963.1 | 2290 | Intron | NP_001077432.1 | |||
NM_001083964.1 | 2290 | Intron | NP_001077433.1 | |||
NM_001083965.1 | 2290 | Intron | NP_001077434.1 | |||
NM_006862.3 | 2290 | Intron | NP_006853.2 | |||
XM_005244856.4 | 2290 | Intron | XP_005244913.1 | |||
XM_017000122.1 | 2290 | Intron | XP_016855611.1 | |||
XM_017000123.1 | 2290 | UTR 3 | XP_016855612.1 | |||
XM_017000124.1 | 2290 | Intron | XP_016855613.1 | |||
XM_017000125.1 | 2290 | Intron | XP_016855614.1 | |||
XM_017000126.1 | 2290 | Intron | XP_016855615.1 | |||
XM_017000127.1 | 2290 | Intron | XP_016855616.1 | |||
XM_017000128.1 | 2290 | Intron | XP_016855617.1 | |||
XM_017000129.1 | 2290 | Intron | XP_016855618.1 | |||
XM_017000130.1 | 2290 | Intron | XP_016855619.1 |