Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTGCTGGGGCTAACCCATGGCATG[A/T]GGTACTGACTTGAAGGGTAGGCAAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
23 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 191315 MIM: 179755 MIM: 604514 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
NTRK1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
NTRK1 - neurotrophic receptor tyrosine kinase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRCC - papillary renal cell carcinoma (translocation-associated) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SH2D2A - SH2 domain containing 2A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001161441.1 | Intron | NP_001154913.1 | ||||
NM_001161442.1 | Intron | NP_001154914.1 | ||||
NM_001161443.1 | Intron | NP_001154915.1 | ||||
NM_001161444.1 | Intron | NP_001154916.1 | ||||
NM_003975.3 | Intron | NP_003966.2 | ||||
XM_006711615.2 | Intron | XP_006711678.1 | ||||
XM_017002762.1 | Intron | XP_016858251.1 | ||||
XM_017002763.1 | Intron | XP_016858252.1 | ||||
XM_017002764.1 | Intron | XP_016858253.1 | ||||
XM_017002765.1 | Intron | XP_016858254.1 | ||||
XM_017002766.1 | Intron | XP_016858255.1 | ||||
XM_017002767.1 | Intron | XP_016858256.1 |