Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGGCATCACCTTCTTCAAGGAGGA[A/G]AACTCCCCGCCTTGGATCGTCTTCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
15 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602989 MIM: 609973 MIM: 609712 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CLK2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CLK2 - CDC like kinase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HCN3 - hyperpolarization activated cyclic nucleotide gated potassium channel 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_020897.2 | 527 | Silent Mutation | GAA,GAG | E,E 121 | NP_065948.1 | |
XM_011509816.2 | 527 | Silent Mutation | GAA,GAG | E,E 74 | XP_011508118.1 | |
XM_011509817.2 | 527 | Silent Mutation | GAA,GAG | E,E 121 | XP_011508119.1 | |
XM_011509818.2 | 527 | Intron | XP_011508120.1 | |||
XM_017001918.1 | 527 | Intron | XP_016857407.1 |
PKLR - pyruvate kinase, liver and RBC | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |