Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTTTGTTTCAGTCCCATCGTCTCAG[A/G]AAGCAACTTGTGAACATCCAGGAGT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
14 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609130 MIM: 602784 MIM: 601882 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
APITD1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
APITD1 - apoptosis-inducing, TAF9-like domain 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
APITD1-CORT - APITD1-CORT readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001243768.1 | Intron | NP_001230697.1 | ||||
NM_001270517.1 | Intron | NP_001257446.1 | ||||
NM_198544.3 | Intron | NP_940946.1 | ||||
NM_199006.2 | Intron | NP_950171.2 |
CORT - cortistatin | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001302.4 | Intron | NP_001293.3 |
DFFA - DNA fragmentation factor subunit alpha | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |