Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTCGGACTTCTCCTTCTCCTTCAT[A/G]TGCAAGAAGACGATGCTGAAGATGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
16 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602202 MIM: 605037 MIM: 608309 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
DDOST PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DDOST - dolichyl-diphosphooligosaccharide--protein glycosyltransferase non-catalytic subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005216.4 | 1487 | Silent Mutation | CAC,CAT | H,H 448 | NP_005207.2 |
KIF17 - kinesin family member 17 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PINK1 - PTEN induced putative kinase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032409.2 | 1487 | Intron | NP_115785.1 |
PINK1-AS - PINK1 antisense RNA | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |