Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCAGGCTCTGCGTGATCCCATATCA[A/G]CCAGCACTGCCTCCAGCTGGAAGTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 112260 MIM: 614579 MIM: 609176 MIM: 610962 | ||||||||||||||||||||
Literature Links: |
BGLAP PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BGLAP - bone gamma-carboxyglutamate protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PAQR6 - progestin and adipoQ receptor family member 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001272104.1 | 1058 | Missense Mutation | GCT,GTT | A,V 277 | NP_001259033.1 | |
NM_001272105.1 | 1058 | Missense Mutation | GCT,GTT | A,V 274 | NP_001259034.1 | |
NM_001272106.1 | 1058 | Silent Mutation | CTG,TTG | L,L 127 | NP_001259035.1 | |
NM_001272107.1 | 1058 | Missense Mutation | GCT,GTT | A,V 171 | NP_001259036.1 | |
NM_001272108.1 | 1058 | Missense Mutation | GCT,GTT | A,V 166 | NP_001259037.1 | |
NM_001272109.1 | 1058 | Silent Mutation | CTG,TTG | L,L 55 | NP_001259038.1 | |
NM_001272110.1 | 1058 | Silent Mutation | CTG,TTG | L,L 55 | NP_001259039.1 | |
NM_001272111.1 | 1058 | Silent Mutation | CTG,TTG | L,L 55 | NP_001259040.1 | |
NM_001272112.1 | 1058 | Silent Mutation | CTG,TTG | L,L 55 | NP_001259041.1 | |
NM_001272113.1 | 1058 | Silent Mutation | CTG,TTG | L,L 55 | NP_001259042.1 | |
NM_024897.3 | 1058 | Silent Mutation | CTG,TTG | L,L 195 | NP_079173.2 | |
NM_198406.2 | 1058 | Missense Mutation | GCT,GTT | A,V 277 | NP_940798.1 | |
XM_005245494.3 | 1058 | Silent Mutation | CTG,TTG | L,L 55 | XP_005245551.1 | |
XM_006711546.2 | 1058 | Silent Mutation | CTG,TTG | L,L 301 | XP_006711609.1 | |
XM_006711547.3 | 1058 | Silent Mutation | CTG,TTG | L,L 301 | XP_006711610.1 | |
XM_006711548.3 | 1058 | Silent Mutation | CTG,TTG | L,L 277 | XP_006711611.1 | |
XM_006711552.2 | 1058 | Silent Mutation | CTG,TTG | L,L 190 | XP_006711615.1 | |
XM_006711553.3 | 1058 | Silent Mutation | CTG,TTG | L,L 190 | XP_006711616.1 | |
XM_011510000.2 | 1058 | Silent Mutation | CTG,TTG | L,L 55 | XP_011508302.1 | |
XM_017002385.1 | 1058 | Silent Mutation | CTG,TTG | L,L 301 | XP_016857874.1 |
PMF1 - polyamine-modulated factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PMF1-BGLAP - PMF1-BGLAP readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SMG5 - SMG5, nonsense mediated mRNA decay factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |