Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGGAAGAGCTAGAGCTCAGATCTCC[A/G]CAGCTGCGAAGGTGGAGGCTCTCTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
5 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 606463 MIM: 606913 | ||||||||||||||||||||
Literature Links: |
FAM189B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAM189B - family with sequence similarity 189 member B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001267608.1 | 2496 | Silent Mutation | NP_001254537.1 | |||
NM_006589.2 | 2496 | Silent Mutation | NP_006580.2 | |||
NM_198264.1 | 2496 | Silent Mutation | NP_937995.1 | |||
XM_005244845.1 | 2496 | Silent Mutation | XP_005244902.1 |
GBA - glucosylceramidase beta | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCAMP3 - secretory carrier membrane protein 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |