Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTCGTAGATCATCCGAGCCACTAC[C/T]GGAATGACCTGTTCAGGACACAGAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 607199 MIM: 608255 | ||||||||||||||||||||
Literature Links: |
C1orf74 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C1orf74 - chromosome 1 open reading frame 74 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
IRF6 - interferon regulatory factor 6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001206696.1 | 1243 | Silent Mutation | CCA,CCG | P,P 301 | NP_001193625.1 | |
NM_006147.3 | 1243 | Silent Mutation | CCA,CCG | P,P 396 | NP_006138.1 |
TRAF3IP3 - TRAF3 interacting protein 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |