Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TAATACCCATTTACCCAGTTCATTC[C/T]GTGCTCTGGGAAGGCATCTGCCCCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
12 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 112260 MIM: 614579 MIM: 609176 MIM: 610962 | ||||||||||||||||||||
Literature Links: |
BGLAP PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BGLAP - bone gamma-carboxyglutamate protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PMF1 - polyamine-modulated factor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PMF1-BGLAP - PMF1-BGLAP readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SMG5 - SMG5, nonsense mediated mRNA decay factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |