Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTTCTTCCTACTGGATCTGGTGCTC[A/G]ACTTCCGAACGGGCATCGTGGTGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 602989 MIM: 609973 MIM: 609712 | ||||||||||||||||||||
Literature Links: |
CLK2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CLK2 - CDC like kinase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HCN3 - hyperpolarization activated cyclic nucleotide gated potassium channel 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_020897.2 | 594 | Missense Mutation | AAC,GAC | N,D 144 | NP_065948.1 | |
XM_011509816.2 | 594 | Missense Mutation | AAC,GAC | N,D 97 | XP_011508118.1 | |
XM_011509817.2 | 594 | Missense Mutation | AAC,GAC | N,D 144 | XP_011508119.1 | |
XM_011509818.2 | 594 | Intron | XP_011508120.1 | |||
XM_017001918.1 | 594 | Intron | XP_016857407.1 |
PKLR - pyruvate kinase, liver and RBC | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |