Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTCAAAGCACCAGCCGCATTCCAA[A/G]CGAGGATTGGGTTGCCATGACAATA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
11 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 158340 MIM: 188062 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MIR92B PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MIR92B - microRNA 92b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MUC1 - mucin 1, cell surface associated | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
THBS3 - thrombospondin 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001252607.1 | Intron | NP_001239536.1 | ||||
NM_001252608.1 | Intron | NP_001239537.1 | ||||
NM_007112.4 | Intron | NP_009043.1 | ||||
XM_006711498.3 | Intron | XP_006711561.1 | ||||
XM_011509926.2 | Intron | XP_011508228.1 | ||||
XM_011509927.2 | Intron | XP_011508229.1 | ||||
XM_011509928.2 | Intron | XP_011508230.1 | ||||
XM_011509929.1 | Intron | XP_011508231.1 | ||||
XM_011509930.2 | Intron | XP_011508232.1 | ||||
XM_011509931.1 | Intron | XP_011508233.1 | ||||
XM_011509932.2 | Intron | XP_011508234.1 | ||||
XM_011509933.1 | Intron | XP_011508235.1 | ||||
XM_011509934.1 | Intron | XP_011508236.1 | ||||
XM_011509935.1 | Intron | XP_011508237.1 | ||||
XM_011509936.1 | Intron | XP_011508238.1 | ||||
XM_017002206.1 | Intron | XP_016857695.1 |