Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAGGCCAAGTTCACTTGCAACACG[A/C]GGCAGCCAGGCTGCGACAACGTCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
2 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 608803 MIM: 139270 MIM: 615316 | ||||||||||||||||||||
Literature Links: |
GJC2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GJC2 - gap junction protein gamma 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_020435.3 | 488 | Silent Mutation | AGG,CGG | R,R 59 | NP_065168.2 |
GUK1 - guanylate kinase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
IBA57 - IBA57 homolog, iron-sulfur cluster assembly | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
IBA57-AS1 - IBA57 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |