Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCTCCAAGCTGCGGATCATGGAGC[A/G]CCTCAGGGGCGGCCCGCAGAGCGAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
20 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 611354 MIM: 615467 MIM: 601365 MIM: 605865 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CPSF3L PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CPSF3L - cleavage and polyadenylation specific factor 3-like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CPTP - ceramide-1-phosphate transfer protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001029885.1 | 612 | Missense Mutation | CAC,CGC | H,R 66 | NP_001025056.1 | |
XM_005244801.3 | 612 | Missense Mutation | CAC,CGC | H,R 66 | XP_005244858.1 | |
XM_005244802.1 | 612 | Missense Mutation | CAC,CGC | H,R 3 | XP_005244859.1 | |
XM_011542200.2 | 612 | Missense Mutation | CAC,CGC | H,R 66 | XP_011540502.1 |
DVL1 - dishevelled segment polarity protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAS1R3 - taste 1 receptor member 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |